Αλληλουχία ολόκληρου του γονιδιώματος: Μια αποτελεσματική στρατηγική για την ανάλυση πληροφοριών εισαγωγής ξένων γονιδίων σε διαγονιδιακά φυτά

By | 5 Μαρτίου, 2023

Αλληλουχία ολόκληρου του γονιδιώματος: Μια αποτελεσματική στρατηγική για την ανάλυση πληροφοριών εισαγωγής ξένων γονιδίων σε διαγονιδιακά φυτά

  • 1 Ινστιτούτο Έρευνας Βιοτεχνολογίας, Κινεζική Ακαδημία Γεωργικών Επιστημών/Βασικό Εργαστήριο MARA για την αξιολόγηση της ασφάλειας (μοριακή) του Agri-GMO, Πεκίνο Κίνα
  • 2 Κέντρο Ανάπτυξης Επιστήμης και Τεχνολογίας/MARA, Πεκίνο, Κίνα

Ο μοριακός χαρακτηρισμός είναι ένα βασικό βήμα στην αξιολόγηση κινδύνου γενετικά τροποποιημένων οργανισμών (ΓΤΟ) για έγκριση από ρυθμιστικές αρχές. Εδώ, περιγράφουμε μια μέθοδο για την ανάλυση του αριθμού αντιγράφων, των τόπων εισαγωγής και των πλευρικών αλληλουχιών μέσω της αλληλουχίας ολόκληρου του γονιδιώματος (WGS) και της βιοπληροφορικής. Ο συνολικός μοριακός χαρακτηρισμός του διαγονιδιακού ρυζιού G2-6 πραγματοποιήθηκε χρησιμοποιώντας αυτόν τον αγωγό. Τα αποτελέσματα έδειξαν ότι ένα αντίγραφο του ξένου γονιδίου εισήχθη στο χρωμόσωμα 8 του ρυζιού. Δεν υπήρξε εισαγωγή ραχοκοκαλιάς φορέα αλλά μια απροσδόκητη εισαγωγή και αναδιάταξη DNA στο 3′ άκρο του Τ-DNA. Λάβαμε επίσης τις πλευρικές αλληλουχίες 5′ και 3′ του Τ-DNA. Τα αποτελέσματά μας πρότειναν ότι η χρήση ενός συνδυασμού WGS και βιοπληροφορικής είναι μια αποτελεσματική στρατηγική για τον μοριακό χαρακτηρισμό των ΓΤΟ.

Εισαγωγή

Ο μοριακός χαρακτηρισμός γενετικά τροποποιημένων οργανισμών (ΓΤΟ), σε επίπεδο γονιδιώματος, συμπεριλαμβανομένων πληροφοριών σχετικά με τον αριθμό αντιγράφων, τη θέση και την ακεραιότητα του εξωγενούς γονιδίου στο φυτικό γονιδίωμα και την πλευρική αλληλουχία DNA ξενιστή του ξένου θραύσματος DNA, είναι το κλειδί για την ανίχνευση διαγονιδιακών συμβάντων . Αυτός ο χαρακτηρισμός είναι ένα βασικό βήμα για την απόκτηση επιθυμητών προϊόντων, ζωτικής σημασίας για την αξιολόγηση της ασφάλειας και η κύρια βάση για την επίβλεψη και τον εντοπισμό της ασφάλειας από τις διοικητικές υπηρεσίες. Αντίστοιχα, ορισμένοι οργανισμοί έχουν παράσχει απαιτήσεις δεδομένων για μοριακό χαρακτηρισμό (Food and Agricultural Organization of the United Nations., 2003; Organization for Economic Cooperation and Development, 2010; EFSA Panel on Genetically Modified Organisms, 2011).

Υπάρχουν διαφορετικές προσεγγίσεις για τον μοριακό χαρακτηρισμό. Southern blotting (Southern, 1975), ψηφιακή PCR (Collier et al., 2017; Sun and Joyce, 2017) και ποσοτική PCR πραγματικού χρόνου (qRT-PCR) (Ingham et al., 2001; Song et al., 2002 Bubner και Baldwin, 2004) είναι αποτελεσματικές μέθοδοι για την ανάλυση αριθμού αντιγράφων. Περπάτημα γονιδιώματος που βασίζεται σε PCR, όπως αντίστροφη PCR (Ochman et al., 1988), PCR με μεσολάβηση προσαρμογέα (Huang et al., 2007) και θερμική ασύμμετρη interlaced PCR (TAIL-PCR) (Liu et al., 1995) , συνδυάζεται με την αλληλουχία Sanger για τον εντοπισμό πλευρικών ακολουθιών (Food and Agricultural Organization of the United Nations., 2003; Li et al., 2017). Αυτές οι τεχνικές έχουν διαφορετικά χαρακτηριστικά και παρουσιάζουν διαφορετικές τεχνικές προκλήσεις. Για παράδειγμα, Το στύπωμα Southern μπορεί να αντανακλά άμεσα τον αριθμό αντιγράφων ενός εξωγενούς γονιδίου σε διαγονιδιακά φυτά και έχει υψηλή ακρίβεια και επαναληψιμότητα. Ωστόσο, είναι εντατική και χρονοβόρα, απαιτεί ειδικευμένους χειριστές και δεν παρέχει πληροφορίες σε επίπεδο αλληλουχίας (Zastrow-Hayes et al., 2015). Οι μέθοδοι που βασίζονται στην PCR δεν επαρκούν για την ανακάλυψη αναδιατάξεων εξωγενών θραυσμάτων DNA, όλων των θέσεων εισαγωγής και των πλευρικών τους αλληλουχιών σε διαγονιδιακά φυτά με εισαγωγή πολλαπλών θέσεων και δεν μπορούν να αναγνωρίσουν μη τεκμηριωμένα μοριακά χαρακτηριστικά σε γενετικά τροποποιημένες καλλιέργειες (Wahler et al., 2013; Li et al. , 2017). Επιπλέον, είναι επειγόντως απαραίτητο να διερευνηθούν νέες στρατηγικές για μοριακό χαρακτηρισμό με την ανάπτυξη στοιβαγμένων γενετικά τροποποιημένων καλλιεργειών και φυτών με γονιδιακή επεξεργασία. απαιτεί ειδικευμένους χειριστές και δεν παρέχει πληροφορίες σε επίπεδο ακολουθίας (Zastrow-Hayes et al., 2015). Οι μέθοδοι που βασίζονται στην PCR δεν επαρκούν για την ανακάλυψη αναδιατάξεων εξωγενών θραυσμάτων DNA, όλων των θέσεων εισαγωγής και των πλευρικών τους αλληλουχιών σε διαγονιδιακά φυτά με εισαγωγή πολλαπλών θέσεων και δεν μπορούν να αναγνωρίσουν μη τεκμηριωμένα μοριακά χαρακτηριστικά σε γενετικά τροποποιημένες καλλιέργειες (Wahler et al., 2013; Li et al. , 2017). Επιπλέον, είναι επειγόντως απαραίτητο να διερευνηθούν νέες στρατηγικές για μοριακό χαρακτηρισμό με την ανάπτυξη στοιβαγμένων γενετικά τροποποιημένων καλλιεργειών και φυτών με γονιδιακή επεξεργασία. απαιτεί ειδικευμένους χειριστές και δεν παρέχει πληροφορίες σε επίπεδο ακολουθίας (Zastrow-Hayes et al., 2015). Οι μέθοδοι που βασίζονται στην PCR δεν επαρκούν για την ανακάλυψη αναδιατάξεων εξωγενών θραυσμάτων DNA, όλων των θέσεων εισαγωγής και των πλευρικών τους αλληλουχιών σε διαγονιδιακά φυτά με εισαγωγή πολλαπλών θέσεων και δεν μπορούν να αναγνωρίσουν μη τεκμηριωμένα μοριακά χαρακτηριστικά σε γενετικά τροποποιημένες καλλιέργειες (Wahler et al., 2013; Li et al. , 2017). Επιπλέον, είναι επειγόντως απαραίτητο να διερευνηθούν νέες στρατηγικές για μοριακό χαρακτηρισμό με την ανάπτυξη στοιβαγμένων γενετικά τροποποιημένων καλλιεργειών και φυτών με γονιδιακή επεξεργασία. και τις πλευρικές τους αλληλουχίες σε διαγονιδιακά φυτά με εισαγωγή πολλών θέσεων και δεν μπορούν να αναγνωρίσουν μη τεκμηριωμένα μοριακά χαρακτηριστικά σε γενετικά τροποποιημένες καλλιέργειες (Wahler et al., 2013; Li et al., 2017). Επιπλέον, είναι επειγόντως απαραίτητο να διερευνηθούν νέες στρατηγικές για μοριακό χαρακτηρισμό με την ανάπτυξη στοιβαγμένων γενετικά τροποποιημένων καλλιεργειών και φυτών με γονιδιακή επεξεργασία. και τις πλευρικές τους αλληλουχίες σε διαγονιδιακά φυτά με εισαγωγή πολλών θέσεων και δεν μπορούν να αναγνωρίσουν μη τεκμηριωμένα μοριακά χαρακτηριστικά σε γενετικά τροποποιημένες καλλιέργειες (Wahler et al., 2013; Li et al., 2017). Επιπλέον, είναι επειγόντως απαραίτητο να διερευνηθούν νέες στρατηγικές για μοριακό χαρακτηρισμό με την ανάπτυξη στοιβαγμένων γενετικά τροποποιημένων καλλιεργειών και φυτών με γονιδιακή επεξεργασία.

Δεδομένης της ανάπτυξης της αλληλουχίας επόμενης γενιάς (NGS) και των εργαλείων βιοπληροφορικής, η αλληλούχιση ολόκληρου του γονιδιώματος (WGS) μπορεί εύκολα να ολοκληρωθεί με χαμηλό κόστος σε σύντομο χρονικό διάστημα και ως εκ τούτου χρησιμοποιείται ευρέως στις βιοεπιστήμες. Το WGS σε συνδυασμό με ανάλυση βιοπληροφορικής έχει χρησιμοποιηθεί για τον προσδιορισμό του αριθμού αντιγράφου, της θέσης εισαγωγής και της πλευρικής αλληλουχίας DNA ξενιστή ξένων θραυσμάτων DNA σε διαγονιδιακό Arabidopsis (Lepage et al., 2013), σόγια (Kovalic et al., 2012; Guo et al., 2012; Guo et al. ., 2016; Guttikonda et al., 2016), ρύζι (Yang et al., 2013; Park et al., 2015, 2017; Zhang et al., 2020) και καλαμπόκι (Cade et al., 2018). Σε σύγκριση με τις μεθόδους Southern blotting και PCR, ο συνδυασμός WGS με de novo συναρμολόγηση και ανάλυση βιοπληροφορικής, που έχει πολλά επιθυμητά χαρακτηριστικά, όπως υψηλό βαθμό τυποποίησης, καλή επαναληψιμότητα, υψηλή αυτοματοποίηση,

Το διαγονιδιακό ρύζι G2-6 φέρει το γονίδιο ανοχής glyphosate G2-aroA και ελήφθη αρχικά χρησιμοποιώντας μετασχηματισμό με τη μεσολάβηση Agrobacterium. Η ανάλυση κηλίδωσης Southern αποκάλυψε ένα αντίγραφο του ξένου γονιδίου στο γονιδίωμα του ρυζιού. Η πλευρική αλληλουχία 3′ άκρου του ξένου θραύσματος DNA δεν ελήφθη με τη μέθοδο γονιδιώματος με τη μεσολάβηση PCR (Dong et al., 2017). Σε αυτή τη μελέτη, προσδιορίσαμε τον αριθμό αντιγράφου, την ακεραιότητα, τη θέση εισαγωγής και την πλευρική αλληλουχία ξένων θραυσμάτων DNA και προσδιορίσαμε την παρουσία ή την απουσία αλληλουχιών κορμού φορέα σε διαγονιδιακά φυτά συνδυάζοντας δεδομένα WGS και ανάλυση βιοπληροφορικής. Σκοπεύαμε να παρέχουμε πληροφορίες για τα πλεονεκτήματα της εφαρμογής διαφορετικών πλατφορμών αλληλούχισης και βάθους αλληλούχισης στον μοριακό χαρακτηρισμό διαγονιδιακών φυτών χρησιμοποιώντας την προσέγγιση WGS.

Υλικά και μέθοδοι

Φυτική ύλη

Τρία δείγματα, το διαγονιδιακό ρύζι G2-6, η συμβατική ποικιλία ρυζιού Zhonghua 11 (ZH11) και ο έλεγχος ακίδας (ZH11-P), χρησιμοποιήθηκαν για ανάλυση WGS. Το διαγονιδιακό ρύζι G2-6 που περιέχει το γονίδιο G2-aroA δημιουργήθηκε με μετασχηματισμό που προκαλείται από το Agrobacterium (Dong et al., 2017). Ο ZH11 ήταν ο αποδέκτης του G2-6. Το ZH11-P παρήχθη μέσω της προσθήκης ενός αντιγράφου ανά πλασμίδιο pUBIG2 DNA ισοδύναμου μετασχηματισμού γονιδιώματος σε ZH11. Αυτή η συχνότητα αντιγραφής προσδιορίστηκε κατά βάρος, με βάση ένα μέγεθος γονιδιώματος ρυζιού 389 Mb, και υπολογίστηκε σύμφωνα με τον αναφερόμενο τύπο. Όλα τα δείγματα έχουν παρόμοιο γενετικό υπόβαθρο. Οι γνωστές αλληλουχίες DNA του pUBIG2 χρησίμευσαν ως αναφορές για αναλύσεις βιοπληροφορικής.

Απομόνωση και ποσοτικοποίηση γονιδιωματικού DNA

Δείγματα ρυζιού φυτεύτηκαν σε θερμοκήπιο στο CAAS. Πέντε φυτά που αναπτύσσονται κανονικά στο ίδιο στάδιο (3-5 φύλλα) επιλέχθηκαν τυχαία από τα G2-6 και ZH11 για την εκχύλιση του συνολικού γονιδιωματικού DNA. Το συνολικό γονιδιωματικό DNA των φύλλων ρυζιού εκχυλίστηκε χρησιμοποιώντας κιτ εξαγωγής DNA. Για να παραχθούν δείγματα θετικού μάρτυρα ακίδας για προσδιορισμό αλληλουχίας, το πλασμιδικό DNA προστέθηκε στο γονιδιωματικό DNA του ZH11 σε ένα αντίγραφο ανά ισοδύναμο γονιδιώματος. Η ποσότητα DNA αξιολογήθηκε με ηλεκτροφόρηση γέλης αγαρόζης 1% και ένα όργανο NanoDrop (Thermo Scientific, Ηνωμένες Πολιτείες).

WGS Χρήση της πλατφόρμας Illumina

Η βιβλιοθήκη DNA προετοιμάστηκε χρησιμοποιώντας ένα κιτ προετοιμασίας βιβλιοθήκης NEBNext Ultra DNA σύμφωνα με το πρωτόκολλο του κατασκευαστή. Το DNA διατμήθηκε τυχαία χρησιμοποιώντας έναν υπερηχητή Covaris (Covaris, Inc.), και τα θραύσματα DNA υποβλήθηκαν σε επιδιόρθωση άκρου, προσθήκη Α-ουράς και σύνδεση προσαρμογέα. Το προκύπτον DNA καθαρίστηκε χρησιμοποιώντας κιτ Agencourt SPRI (Beckman Coulter Life Sciences, Ηνωμένες Πολιτείες) για την επιλογή θραυσμάτων DNA με μέσο μέγεθος ένθετου 350 bp. Τα θραύσματα DNA με μόρια προσαρμογής στα άκρα 5′ και 3′ εμπλουτίστηκαν επιλεκτικά με PCR και οι βιβλιοθήκες ανιχνεύθηκαν χρησιμοποιώντας μια δοκιμασία NGS 3K/Caliper και ποσοτικοποιήθηκαν με qPCR.

Κατασκευάστηκαν τέσσερις βιβλιοθήκες DNA, που περιείχαν βιβλιοθήκη DNA αρνητικού μάρτυρα ZH11, δύο βιβλιοθήκες DNA διαγονιδιακών G2-6 ρυζιού (η μία είναι για αλληλουχία 70 χ, η άλλη για αλληλουχία 30 χ), και μια βιβλιοθήκη DNA θετικού ελέγχου με ακίδα. Οι βιβλιοθήκες DNA αναλύθηκαν με αλληλουχία 150 bp με ζεύγη άκρων σε ένα όργανο Illumina HiSeq 4000 (Illumina, San Diego, CA, Ηνωμένες Πολιτείες) ακολουθώντας το πρωτόκολλο του κατασκευαστή.

WGS Χρήση της πλατφόρμας PacBio

Το γονιδιωματικό DNA κατακερματίστηκε χρησιμοποιώντας βελόνα 26-G. Τα κομμένα θραύσματα DNA υποβλήθηκαν σε επιδιόρθωση βλάβης DNA και καθαρίστηκαν χρησιμοποιώντας το σύστημα αυτόματης ηλεκτροφόρησης νουκλεϊκού οξέος και ανάκτησης θραυσμάτων BluePippin και ένα κιτ αντιδραστηρίου BluePippin για την επιλογή θραυσμάτων DNA μεγαλύτερα από 20 kb. Το DNA που προέκυψε επισκευάστηκε στο τέλος και ο προσαρμογέας απολινώθηκε χρησιμοποιώντας ένα κιτ προετοιμασίας βιβλιοθήκης NEBNext Ultra DNA. Η βιβλιοθήκη DNA αλληλουχήθηκε στην πλατφόρμα PacBio Sequel. Κατασκευάζονται δύο βιβλιοθήκες. Το ένα είναι μια βιβλιοθήκη DNA για το G2-6 και το άλλο είναι για το ZH11.

Μοριακός χαρακτηρισμός με χρήση δεδομένων αλληλουχίας Illumina

Οι ακατέργαστες αναγνώσεις αλληλουχίας φιλτραρίστηκαν για να ληφθούν καθαρές αναγνώσεις αφαιρώντας τις ακολουθίες προσαρμογέα και τις ακολουθίες με βαθμολογίες Phred κάτω από 20 χρησιμοποιώντας το λογισμικό FastQC. Οι καθαρές αναγνώσεις χαρτογραφήθηκαν στην αλληλουχία πλασμιδίου pUBIG2 χρησιμοποιώντας το λογισμικό Burrows–Wheeler Aligner (BWA) 0.7.17 (Li and Durbin, 2009). Οι αναγνώσεις οργανώθηκαν σε τρεις ομάδες: (1) αναγνώσεις που ταίριαζαν πλήρως με την αλληλουχία πλασμιδίου pUBIG2. (2) διαβάζει ότι ταίριαζε εν μέρει με την αλληλουχία πλασμιδίου pUBIG2, η οποία προήλθε από τη θέση των θέσεων εισαγωγής που εκτείνονταν στη διασταύρωση μεταξύ των αλληλουχιών εισαγωγής και φυτών. και (3) αναγνώσεις που δεν ταίριαζαν με την αλληλουχία πλασμιδίου pUBIG2, που προήλθαν από το γονιδίωμα του δέκτη. Οι αναγνώσεις που προέρχονται πλήρως ή εν μέρει από το πλασμίδιο pUBIG2 ήταν μετατροπή μορφής, διάταξη και αποδιπλασιασμός με χρήση εργαλείων Ευθυγράμμισης Αλληλουχίας/Χάρτη (έκδοση 1 SAMtools. 6) και οπτικοποιήθηκε με το Integrative Genomic Viewer (IGV) (Συμπληρωματικό Σχήμα S1). Από τα αποτελέσματα του IGV, χρησιμοποιήθηκαν αναγνώσεις που ταιριάζουν με τις αλληλουχίες πλασμιδίου για την αναδόμηση της υπολειπόμενης δομής κορμού της εισαγόμενης αλληλουχίας και τον προσδιορισμό του αριθμού αντιγράφου. Οι αναγνώσεις με το ένα άκρο χαρτογραφημένο στην αλληλουχία αναφοράς και το άλλο χαρτογραφημένο στο άκρο του Τ-DNA συλλέχθηκαν και υποβλήθηκαν σε ευθυγράμμιση πολλαπλών αλληλουχιών για να προσδιοριστεί η θέση εισαγωγής και η πλευρική αλληλουχία χρησιμοποιώντας NCBI BLAST έναντι του γονιδιώματος αναφοράς ρυζιού (Oryza sativa) .

Μοριακός χαρακτηρισμός με χρήση δεδομένων αλληλουχίας PacBio

Οι αναγνώσεις πολυμεράσης διαχωρίστηκαν από τους προσαρμογείς και φιλτραρίστηκαν για να ληφθούν υποαναγνώσεις χρησιμοποιώντας το λογισμικό SMRT Link v4.0. Στη συνέχεια, οι δευτερεύουσες μετρήσεις φιλτραρίστηκαν για να αφαιρεθούν εκείνες με ελάχιστο μήκος μικρότερο από 50 bp και ποιότητα ανάγνωσης κάτω από 0,8. Οι καθαρές αναγνώσεις χαρτογραφήθηκαν στην αλληλουχία πλασμιδίου pUBIG2 χρησιμοποιώντας το λογισμικό Minimap2 (Li, 2018).

Επιβεβαίωση των θέσεων εισαγωγής και των πλευρικών αλληλουχιών με PCR και Sanger Sequencing

Primers 6-3-F (CTGCACTTCAAACAAGTGTGACA), 6-3-R (ACGACGCCGTGACCACATGCAT), 6-5-F (CCGTATCGC TGTTCAAAACG) και 6-5-R (GAAATAGAGTAGATGC CGACCG) ειδικά για το ένθετο T-DNA Σχεδιάστηκε DNA του ρυζιού G2-6 GM. Η ενίσχυση πραγματοποιήθηκε υπό τις ακόλουθες συνθήκες: 98°C για 30 δευτερόλεπτα, ακολουθούμενο από 35 κύκλους των 98°C για 10 δευτερόλεπτα, 65°C για 15 δευτερόλεπτα και 65°C για 15 δευτερόλεπτα. Τα προϊόντα PCR αλληλουχήθηκαν με προσδιορισμό αλληλουχίας Sanger.

Αποτελέσματα

Ροή εργασιών για μοριακό χαρακτηρισμό με χρήση WGS

Αναπτύξαμε μια διοχέτευση για τον εντοπισμό του αριθμού αντιγράφων, των τόπων εισαγωγής και των πλευρικών ακολουθιών χρησιμοποιώντας δεδομένα WGS αντί για συμβατικές μεθόδους ανίχνευσης. Ένα διάγραμμα του αγωγού φαίνεται στο Σχήμα 1. Τα αναγνωρισμένα δεδομένα αλληλουχίας ευθυγραμμίστηκαν με μια ακολουθία διανύσματος μετασχηματισμού χρησιμοποιώντας το λογισμικό Burrows–Wheeler Aligner με μέγιστες ακριβείς αντιστοιχίσεις (BWA-MEM) (Li and Durbin, 2009). Οι χαρτογραφημένες αναγνώσεις ταξινομήθηκαν σε τρεις ομάδες με βάση τη θέση Τ-DNA. Οι κατηγορίες αναγνώσεων που αντιστοιχίστηκαν πλήρως στο διάνυσμα μετασχηματισμού συνδέθηκαν για να αναλυθεί η ραχοκοκαλιά εισαγωγή και ενσωμάτωση της εισαγωγής Τ-DNA. Οι αναγνώσεις με μερική αντιστοίχιση στην ακολουθία διανύσματος μετασχηματισμού θα παραπέμπονται σε αναγνώσεις διασταύρωσης και θα χρησιμοποιηθούν για τον προσδιορισμό της θέσης εισαγωγής. Ο αριθμός αντιγράφων υπολογίστηκε συγκρίνοντας την κάλυψη του T-DNA μεταξύ διαγονιδιακού συμβάντος και δείγματος θετικού μάρτυρα ακίδας, για παράδειγμα, εάν υπάρχουν δύο περιπτώσεις αναγνώσεων διασταύρωσης και η κάλυψη των αναγνώσεων είναι παρόμοια με το δείγμα θετικού μάρτυρα ακίδας Αυτό σημαίνει έναν αριθμό αντιγράφου και μία θέση εισαγωγής ξένου γονιδίου στο γονιδίωμα του δέκτη. Ο αριθμός αντιγράφου του T-DNA και της εισαγωγής κορμού μπορεί να είναι παρών μέσω οπτικοποιημένης ανάλυσης χρησιμοποιώντας λογισμικό IGV. Οι αναγνώσεις που χαρτογραφούνται στην περιοχή σύνδεσης του T-DNA και του γονιδιώματος του ρυζιού εξήχθησαν χρησιμοποιώντας το πρόγραμμα σεναρίου Python. Η πλευρική αλληλουχία και οι τόποι εισαγωγής μπορούν να ληφθούν μέσω της συναρμολόγησης ακολουθίας χρησιμοποιώντας το λογισμικό SOAPdenovo με βάση τις αναγνώσεις διασταύρωσης που έχουν εξαχθεί και το NCBI BLAST. Ο λεπτομερής μοριακός χαρακτηρισμός του διαγονιδιακού συμβάντος μπορεί να αποκτηθεί με την παραπάνω διαδικασία ανάλυσης. για παράδειγμα, εάν υπάρχουν δύο περιπτώσεις αναγνώσεων διασταύρωσης και η κάλυψη των αναγνώσεων είναι παρόμοια με το δείγμα θετικού μάρτυρα αύξησης, αυτό σημαίνει έναν αριθμό αντιγράφου και μία θέση εισαγωγής ξένου γονιδίου στο γονιδίωμα του δέκτη. Ο αριθμός αντιγράφου του T-DNA και της εισαγωγής κορμού μπορεί να είναι παρών μέσω οπτικοποιημένης ανάλυσης χρησιμοποιώντας λογισμικό IGV. Οι αναγνώσεις που χαρτογραφούνται στην περιοχή σύνδεσης του T-DNA και του γονιδιώματος του ρυζιού εξήχθησαν χρησιμοποιώντας το πρόγραμμα σεναρίου Python. Η πλευρική αλληλουχία και οι τόποι εισαγωγής μπορούν να ληφθούν μέσω της συναρμολόγησης ακολουθίας χρησιμοποιώντας το λογισμικό SOAPdenovo με βάση τις αναγνώσεις διασταύρωσης που έχουν εξαχθεί και το NCBI BLAST. Ο λεπτομερής μοριακός χαρακτηρισμός του διαγονιδιακού συμβάντος μπορεί να αποκτηθεί με την παραπάνω διαδικασία ανάλυσης. για παράδειγμα, εάν υπάρχουν δύο περιπτώσεις αναγνώσεων διασταύρωσης και η κάλυψη των αναγνώσεων είναι παρόμοια με το δείγμα θετικού μάρτυρα αύξησης, αυτό σημαίνει έναν αριθμό αντιγράφου και μία θέση εισαγωγής ξένου γονιδίου στο γονιδίωμα του δέκτη. Ο αριθμός αντιγράφου του T-DNA και της εισαγωγής κορμού μπορεί να είναι παρών μέσω οπτικοποιημένης ανάλυσης χρησιμοποιώντας λογισμικό IGV. Οι αναγνώσεις που χαρτογραφούνται στην περιοχή σύνδεσης του T-DNA και του γονιδιώματος του ρυζιού εξήχθησαν χρησιμοποιώντας το πρόγραμμα σεναρίου Python. Η πλευρική αλληλουχία και οι τόποι εισαγωγής μπορούν να ληφθούν μέσω της συναρμολόγησης ακολουθίας χρησιμοποιώντας το λογισμικό SOAPdenovo με βάση τις αναγνώσεις διασταύρωσης που έχουν εξαχθεί και το NCBI BLAST. Ο λεπτομερής μοριακός χαρακτηρισμός του διαγονιδιακού συμβάντος μπορεί να αποκτηθεί με την παραπάνω διαδικασία ανάλυσης. εάν υπάρχουν δύο περιπτώσεις αναγνώσεων σύνδεσης και η κάλυψη των αναγνώσεων είναι παρόμοια με το δείγμα θετικού μάρτυρα ακίδας, αυτό σημαίνει έναν αριθμό αντιγράφου και μία θέση εισαγωγής ξένου γονιδίου στο γονιδίωμα του δέκτη. Ο αριθμός αντιγράφου του T-DNA και της εισαγωγής κορμού μπορεί να είναι παρών μέσω οπτικοποιημένης ανάλυσης χρησιμοποιώντας λογισμικό IGV. Οι αναγνώσεις που χαρτογραφούνται στην περιοχή σύνδεσης του T-DNA και του γονιδιώματος του ρυζιού εξήχθησαν χρησιμοποιώντας το πρόγραμμα σεναρίου Python. Η πλευρική αλληλουχία και οι τόποι εισαγωγής μπορούν να ληφθούν μέσω της συναρμολόγησης ακολουθίας χρησιμοποιώντας το λογισμικό SOAPdenovo με βάση τις αναγνώσεις διασταύρωσης που έχουν εξαχθεί και το NCBI BLAST. Ο λεπτομερής μοριακός χαρακτηρισμός του διαγονιδιακού συμβάντος μπορεί να αποκτηθεί με την παραπάνω διαδικασία ανάλυσης. εάν υπάρχουν δύο περιπτώσεις αναγνώσεων σύνδεσης και η κάλυψη των αναγνώσεων είναι παρόμοια με το δείγμα θετικού μάρτυρα ακίδας, αυτό σημαίνει έναν αριθμό αντιγράφου και μία θέση εισαγωγής ξένου γονιδίου στο γονιδίωμα του δέκτη. Ο αριθμός αντιγράφου του T-DNA και της εισαγωγής κορμού μπορεί να είναι παρών μέσω οπτικοποιημένης ανάλυσης χρησιμοποιώντας λογισμικό IGV. Οι αναγνώσεις που χαρτογραφούνται στην περιοχή σύνδεσης του T-DNA και του γονιδιώματος του ρυζιού εξήχθησαν χρησιμοποιώντας το πρόγραμμα σεναρίου Python. Η πλευρική αλληλουχία και οι τόποι εισαγωγής μπορούν να ληφθούν μέσω της συναρμολόγησης ακολουθίας χρησιμοποιώντας το λογισμικό SOAPdenovo με βάση τις αναγνώσεις διασταύρωσης που έχουν εξαχθεί και το NCBI BLAST. Ο λεπτομερής μοριακός χαρακτηρισμός του διαγονιδιακού συμβάντος μπορεί να αποκτηθεί με την παραπάνω διαδικασία ανάλυσης. Ο αριθμός αντιγράφου του T-DNA και της εισαγωγής κορμού μπορεί να είναι παρών μέσω οπτικοποιημένης ανάλυσης χρησιμοποιώντας λογισμικό IGV. Οι αναγνώσεις που χαρτογραφούνται στην περιοχή σύνδεσης του T-DNA και του γονιδιώματος του ρυζιού εξήχθησαν χρησιμοποιώντας το πρόγραμμα σεναρίου Python. Η πλευρική αλληλουχία και οι τόποι εισαγωγής μπορούν να ληφθούν μέσω της συναρμολόγησης ακολουθίας χρησιμοποιώντας το λογισμικό SOAPdenovo με βάση τις αναγνώσεις διασταύρωσης που έχουν εξαχθεί και το NCBI BLAST. Ο λεπτομερής μοριακός χαρακτηρισμός του διαγονιδιακού συμβάντος μπορεί να αποκτηθεί με την παραπάνω διαδικασία ανάλυσης. Ο αριθμός αντιγράφου του T-DNA και της εισαγωγής κορμού μπορεί να είναι παρών μέσω οπτικοποιημένης ανάλυσης χρησιμοποιώντας λογισμικό IGV. Οι αναγνώσεις που χαρτογραφούνται στην περιοχή σύνδεσης του T-DNA και του γονιδιώματος του ρυζιού εξήχθησαν χρησιμοποιώντας το πρόγραμμα σεναρίου Python. Η πλευρική αλληλουχία και οι τόποι εισαγωγής μπορούν να ληφθούν μέσω της συναρμολόγησης ακολουθίας χρησιμοποιώντας το λογισμικό SOAPdenovo με βάση τις αναγνώσεις διασταύρωσης που έχουν εξαχθεί και το NCBI BLAST. Ο λεπτομερής μοριακός χαρακτηρισμός του διαγονιδιακού συμβάντος μπορεί να αποκτηθεί με την παραπάνω διαδικασία ανάλυσης.

Φιγούρα 1.Αγωγός για τον μοριακό χαρακτηρισμό διαγονιδιακών φυτών με τη μέθοδο WGS. Βήμα 1: Βιβλιοθήκη DNA που προετοιμάστηκε σύμφωνα με την ανάγκη διαφορετικών πλατφορμών αλληλούχισης. Βήμα 2: λήφθηκαν καθαρές αναγνώσεις μέσω του λογισμικού FASTQC/SMART Link από ακατέργαστα δεδομένα αλληλουχίας. Στη συνέχεια, οι καθαρές αναγνώσεις χαρτογραφήθηκαν σε μια αλληλουχία pUBIG2 φορέα μετασχηματισμού χρησιμοποιώντας λογισμικό BWA/Minimap2. Οι καθαρές αναγνώσεις διευκρινίστηκαν σε τέσσερις τύπους: πλήρως χαρτογραφημένες στην περιοχή T-DNA, πλήρως αντιστοιχισμένες στην περιοχή ραχοκοκαλιάς, εν μέρει αντιστοιχισμένες στην περιοχή T-DNA και οι αναγνώσεις δεν αντιστοιχίζονται στην ακολουθία φορέα. Βήμα 3: οι αντιστοιχισμένες αναγνώσεις οπτικοποιήθηκαν από το λογισμικό IGV μετά τη μετατροπή μορφής, τη διευθέτηση και την αποδιπλοποίηση χρησιμοποιώντας το SAMtool. Ο αριθμός αντιγράφων του Τ-DNA και της εισαγωγής κορμού λήφθηκε σύμφωνα με τον αριθμό του αριθμού της θέσης σύνδεσης και την κάλυψη σε σύγκριση με τον θετικό μάρτυρα ακίδας με το ίδιο βάθος αλληλουχίας. Βήμα 4: Οι αναγνώσεις που περιέχουν την αλληλουχία της περιοχής σύνδεσης μεταξύ του Τ-DNA και του γονιδιώματος του αποδέκτη επιτεύχθηκαν μέσω της διαδικασίας σεναρίου Python ή της ανάλυσης IGV. Στη συνέχεια, το θραύσμα DNA που περιέχει την αλληλουχία σύνδεσης ελήφθη μέσω του λογισμικού συναρμολόγησης αλληλουχίας SOAPdenovo με βάση τις εξαγόμενες αναγνώσεις της περιοχής σύνδεσης και BLAST στο γονιδίωμα αναφοράς του δέκτη. Η θέση εισαγωγής Τ-DNA και η πλευρική αλληλουχία βρέθηκαν σύμφωνα με το αποτέλεσμα BLAST. Τα βήματα που σημειώνονται από τα κόκκινα πλαίσια χρειάζονται μόνο για την πλατφόρμα αλληλουχίας Illumina. Οι αναγνώσεις που περιέχουν την αλληλουχία της περιοχής σύνδεσης μεταξύ του Τ-DNA και του γονιδιώματος του αποδέκτη επιτεύχθηκαν μέσω της διαδικασίας Python script ή ανάλυσης IGV. Στη συνέχεια, το θραύσμα DNA που περιέχει την αλληλουχία σύνδεσης ελήφθη μέσω του λογισμικού συναρμολόγησης αλληλουχίας SOAPdenovo με βάση τις εξαγόμενες αναγνώσεις της περιοχής σύνδεσης και BLAST στο γονιδίωμα αναφοράς του δέκτη. Η θέση εισαγωγής Τ-DNA και η πλευρική αλληλουχία βρέθηκαν σύμφωνα με το αποτέλεσμα BLAST. Τα βήματα που σημειώνονται από τα κόκκινα πλαίσια χρειάζονται μόνο για την πλατφόρμα αλληλουχίας Illumina. Οι αναγνώσεις που περιέχουν την αλληλουχία της περιοχής σύνδεσης μεταξύ του Τ-DNA και του γονιδιώματος του αποδέκτη επιτεύχθηκαν μέσω της διαδικασίας Python script ή ανάλυσης IGV. Στη συνέχεια, το θραύσμα DNA που περιέχει την αλληλουχία σύνδεσης ελήφθη μέσω του λογισμικού συναρμολόγησης αλληλουχίας SOAPdenovo με βάση τις εξαγόμενες αναγνώσεις της περιοχής σύνδεσης και BLAST στο γονιδίωμα αναφοράς του δέκτη. Η θέση εισαγωγής Τ-DNA και η πλευρική αλληλουχία βρέθηκαν σύμφωνα με το αποτέλεσμα BLAST. Τα βήματα που σημειώνονται από τα κόκκινα πλαίσια χρειάζονται μόνο για την πλατφόρμα αλληλουχίας Illumina. Η θέση εισαγωγής Τ-DNA και η πλευρική αλληλουχία βρέθηκαν σύμφωνα με το αποτέλεσμα BLAST. Τα βήματα που σημειώνονται από τα κόκκινα πλαίσια χρειάζονται μόνο για την πλατφόρμα αλληλουχίας Illumina. Η θέση εισαγωγής Τ-DNA και η πλευρική αλληλουχία βρέθηκαν σύμφωνα με το αποτέλεσμα BLAST. Τα βήματα που σημειώνονται από τα κόκκινα πλαίσια χρειάζονται μόνο για την πλατφόρμα αλληλουχίας Illumina.

WGS διαγονιδιακού ρυζιού G2-6

Με την πλατφόρμα αλληλουχίας Illumina, ελήφθησαν συνολικά 9,13–48,50 Gb καθαρών βάσεων από τα δείγματα, που αντιστοιχούν σε κάλυψη 23× έως 125× του γονιδιώματος του ρυζιού. Το ποσοστό των δεδομένων αλληλουχίας με βαθμολογίες ποιότητας τύπου Phred υψηλότερες από 30 ήταν μεγαλύτερο από 90%, υποδεικνύοντας την υψηλή ποιότητα των δεδομένων αλληλουχίας (Πίνακας 1). Τα δεδομένα αλληλουχίας 20× και 40× του G2-6 προέρχονται από υποδειγματοληψία από δεδομένα αλληλουχίας 70×. τα δεδομένα αλληλουχίας 30× προέρχονται από μια άλλη εκτέλεση αλληλουχίας χρησιμοποιώντας άλλη βιβλιοθήκη DNA.

Πίνακας 1. Στατιστικά στοιχεία ποιοτικού ελέγχου αλληλουχίας Illumina.

Με την πλατφόρμα αλληλουχίας PacBio, το μήκος των ενεργών υποαναγνώσεων ήταν μεγαλύτερο από 9000 bp (Πίνακας 2). Τα ποσοστά έγκυρων αναγνώσεων πολυμεράσης και υποαναγνώσεων ήταν 38,9 και 45,7%, αντίστοιχα. Αυτά τα αποτελέσματα έδειξαν ότι τα δεδομένα αλληλουχίας ήταν άφθονα και αξιόπιστα.

Πίνακας 2. Στατιστικά του ποιοτικού ελέγχου αλληλουχίας PacBio.

Μοριακός Χαρακτηρισμός Διαγονιδιακού Ρυζιού G2-6 μέσω Δεδομένων Αλληλουχίας Illumina

Οι καθαρές αναγνώσεις χαρτογραφήθηκαν στην αλληλουχία του φορέα pUBG2. Οι αναγνώσεις που περιέχουν την αλληλουχία θέσης σύνδεσης και την αλληλουχία φορέα επιλέχθηκαν και ευθυγραμμίστηκαν με ολόκληρη την αλληλουχία Τ-DNA για να προσδιοριστεί η θέση εισαγωγής, ο αριθμός αντιγράφου και η ακεραιότητα της αλληλουχίας εισαγωγής.

Λήφθηκαν συνολικά 11 έως 121 αναγνώσεις σύνδεσης από τα δεδομένα αλληλουχίας G2-6 με διαφορετικά βάθη αλληλούχισης (Πίνακας 3). Σύμφωνα με τα αποτελέσματα της ανάλυσης IGV, το βάθος κάλυψης T-DNA ήταν το ίδιο με αυτό για το zh11-P στο ίδιο βάθος αλληλουχίας, αλλά το βάθος κάλυψης στο 5′ άκρο του T-DNA ήταν σχεδόν 2 φορές μεγαλύτερο από αυτό των άλλων τμημάτων του Τ-DNA (Εικόνες 2Α, Β). Έδειξε ότι αυτή η περιοχή Τ-DNA μπορεί να έχει αναδιάταξη DNA. Βρέθηκαν δύο θέσεις σύνδεσης σε όλα τα βάθη αλληλουχίας (Εικόνες 2Β, Γ). Δεν χαρτογραφήθηκαν αναγνώσεις στην περιοχή ραχοκοκαλιάς της αλληλουχίας φορέα pUBIG2 όταν το βάθος προσδιορισμού αλληλουχίας ήταν 20× ή 30×. Ωστόσο, 1 ανάγνωση και 3 αναγνώσεις χαρτογραφήθηκαν στην περιοχή των 4427–4663 bp του κορμού του φορέα όταν το βάθος αλληλουχίας ήταν 40× και 70×, αντίστοιχα (Εικόνες 2Α, Β).

Πίνακας 3. Στατιστικά αποτελέσματα για τις αναγνώσεις που αντιστοιχίζονται σε διαφορετικές διανυσματικές περιοχές.

Εικόνα 2. Ανάλυση πληροφοριών εισαγωγής του G2-6 χρησιμοποιώντας τη μέθοδο WGS και την πλατφόρμα Illumina. (Α) Απεικόνιση του φορέα μετασχηματισμού pUBIG2 που περιέχει Τ-DNA. Το πλήρες μήκος του διανύσματος ήταν 13512 bp. Η περιοχή T-DNA βρίσκεται από 6295 έως 61 bp. (Β) Λεπτομερή αποτελέσματα ανάλυσης IGV του G2-6 για διαφορετικά βάθη αλληλουχίας και θετικούς και αρνητικούς μάρτυρες. Τα ροζ κουτιά υποδεικνύουν την περιοχή σύνδεσης μεταξύ του ορίου T-DNA και του γονιδιώματος του ρυζιού. (ΝΤΟ)Οι ευθυγραμμίσεις αλληλουχίας της περιοχής διασταύρωσης διαβάζονται (το επάνω πλαίσιο παρουσιάζει τις πλευρικές ακολουθίες του 5′ άκρου του Τ-DNA και το κάτω πλαίσιο παρουσιάζει τις πλευρικές ακολουθίες του άκρου 3′ του Τ-DNA). Οι κόκκινες, μαύρες και πράσινες αλληλουχίες νουκλεοτιδίων αντιπροσωπεύουν την αλληλουχία του γονιδιώματος του ρυζιού, την αλληλουχία Τ-DNA και την προβλεπόμενη αλληλουχία εισαγωγής, αντίστοιχα. (Δ) Ο σκιαγραφικός χάρτης των πληροφοριών εισαγωγής Τ-DNA στο γονιδίωμα του ρυζιού. Το Τ-DNA εισήχθη στη θέση ρυζιού Chr8 23685287. (α) T-DNA από 24 έως 246 bp. (β) το μερικό θραύσμα της επιδιωκόμενης εισαγωγής, την αντίστροφη και συμπληρωματική αλληλουχία του Τ-DNA από 24 έως 246 bp.

Οι αναγνώσεις σύνδεσης που ελήφθησαν από διαγονιδιακό ρύζι G2-6 (βάθος αλληλουχίας: 70χ) συναρμολογήθηκαν de novo χρησιμοποιώντας λογισμικό SOAPdenovo. Αλληλουχίες σύνδεσης 604 bp ελήφθησαν από το 5′ άκρο της εισαγωγής Τ-DNA. Μέσω της ευθυγράμμισης και της ανάλυσης BLAST, η αλληλουχία σύνδεσης 5′ άκρου βρέθηκε να περιέχει μια αλληλουχία γονιδιώματος ρυζιού 278 bp, η οποία χαρτογραφήθηκε σωστά στην περιοχή 23685010-23685287 bp του χρωμοσώματος 8 και ένα διάνυσμα 326 bp ακολουθίας, που χαρτογραφήθηκε σωστά στην περιοχή Τ-DNA από 24 έως 350 bp. Αλληλουχίες σύνδεσης 365 bp ελήφθησαν από το 3′ άκρο της εισαγωγής Τ-DNA. Από αυτήν την αλληλουχία, 123 bp ήταν το 3′ άκρο του T-DNA, 223 bp ήταν η αντίστροφη και συμπληρωματική αλληλουχία του 5′ άκρου του T-DNA από 24 έως 246 bp (Εικόνα 2D), και κανένα DNA γονιδιώματος ρυζιού Αποκτήθηκε.

Το παραπάνω αποτέλεσμα σημαίνει ότι το Τ-DNA εισήχθη στη θέση 23685287 bp του χρωμοσώματος 8 και υπήρξε μια ακούσια εισαγωγή στο άκρο 3′.

Μοριακός χαρακτηρισμός διαγονιδιακού ρυζιού G2-6 μέσω δεδομένων αλληλουχίας PacBio

Τα υποδιαγράμματα χαρτογραφήθηκαν στην ακολουθία του φορέα pUBIG2 χρησιμοποιώντας έξυπνο λογισμικό. Οι αναγνώσεις που περιέχουν την αλληλουχία θέσης σύνδεσης και την αλληλουχία φορέα επιλέχθηκαν για περαιτέρω ανάλυση. Έντεκα και επτά αναγνώσεις διασταύρωσης λήφθηκαν μέσω ανάλυσης. Τα αποτελέσματα της ανάλυσης IGV αποκάλυψαν δύο θέσεις διασταύρωσης (Εικόνα 3Α).

Σχήμα 3. Λεπτομερή αποτελέσματα ανάλυσης IGV του G2-6 χρησιμοποιώντας δεδομένα αλληλουχίας PacBio. (Α) Απεικόνιση του φορέα μετασχηματισμού pUBIG2 που περιέχει Τ-DNA. Το πλήρες μήκος του διανύσματος ήταν 13512 bp. Η περιοχή T-DNA βρίσκεται από 6295 έως 61 bp. (Β) Λεπτομερή αποτελέσματα της ανάλυσης IGV του G2-6 χρησιμοποιώντας δεδομένα αλληλουχίας PacBio. (Γ) Οι ευθυγραμμίσεις ακολουθίας διασταυρώσεων-περιοχής διαβάζονται. Το επάνω πλαίσιο παρουσιάζει τις πλευρικές αλληλουχίες του 5′ άκρου του Τ-DNA. Το κάτω πλαίσιο παρουσιάζει τις πλευρικές αλληλουχίες του 3′ άκρου του Τ-DNA και την προβλεπόμενη εισαγωγή.

Επιλέχθηκαν δύο αναγνώσεις από τη θέση σύνδεσης 5′ για ευθυγράμμιση με το γονιδίωμα αναφοράς του ρυζιού. Μια αλληλουχία σύνδεσης 1973 bp λήφθηκε από τη θέση σύνδεσης 5′. Αυτό το θραύσμα DNA περιείχε μια αλληλουχία T-DNA 1390 bp, η οποία χαρτογραφήθηκε σωστά στην περιοχή T-DNA από 24 έως 1408 bp, και μια αλληλουχία γονιδιώματος ρυζιού 583 bp, η οποία χαρτογραφήθηκε σωστά στην περιοχή 23684706-23685287-bp του χρωμοσώματος 8 ρυζιού. Παρατηρήθηκε διαγραφή 23 bp στην περιοχή Τ-DNA (Εικόνα 3Β). Αυτό το αποτέλεσμα είναι συνεπές με τα αποτελέσματα από τα δεδομένα αλληλουχίας Illumina.

Επιλέχθηκαν δύο αναγνώσεις από τη θέση σύνδεσης 3′ για ευθυγράμμιση με το γονιδίωμα αναφοράς του ρυζιού. Λήφθηκε μια αλληλουχία σύνδεσης 3720 bp. Το θραύσμα DNA περιείχε μια αλληλουχία Τ-DNA 532 bp, η οποία χαρτογραφήθηκε κατάλληλα στην περιοχή Τ-DNA από 6701 έως 7233 bp. μια αλληλουχία 327 bp, η οποία ήταν η αντίστροφη και συμπληρωματική αλληλουχία του T-DNA από την περιοχή 24 έως 351 bp. μια αλληλουχία 134 bp, η οποία ήταν η αντίστροφη και συμπληρωματική αλληλουχία της περιοχής από 23685154 έως 23685287 bp στο χρωμόσωμα 8 ρυζιού. και μια αλληλουχία 2639 bp, η οποία χαρτογραφήθηκε σωστά στην περιοχή 23685318 έως 23687941 bp του χρωμοσώματος 8 ρυζιού. Παρατηρήθηκε διαγραφή 46 bp στο δεξιό όριο (RB) του T-DNA (Εικόνα 3C).

Όλα τα αποτελέσματα έδειξαν ένα μόνο αντίγραφο του Τ-DNA που εισήχθη στο γονιδίωμα του ρυζιού, μια διαγραφή 23 bp στο αριστερό περίγραμμα (LB), μια διαγραφή 49 bp στο RB και καμία εισαγωγή στη ραχοκοκαλιά. Ο τόπος εισαγωγής εντοπίστηκε στο χρωμόσωμα 8 από 23685287 έως 23685318 bp, με διαγραφή 31 bp. Μια απροσδόκητη αλληλουχία εισαγωγής 549 bp βρέθηκε μεταξύ του RB του T-DNA και της θέσης 23685318 bp του χρωμοσώματος 8 του ρυζιού, η οποία συνέβη κατά τη διάρκεια του μετασχηματισμού του φυτού (Εικόνα 4).

Εικόνα 4. Πληροφορίες εισαγωγής Τ-DNA για το G2-6.

Επιβεβαίωση θέσεων εισαγωγής και πλευρικών ακολουθιών με ενίσχυση PCR και αλληλουχία Sanger

Για την επικύρωση των παραπάνω αποτελεσμάτων σχετικά με τη θέση του T-DNA στο G2-6, σχεδιάσαμε εκκινητές σύμφωνα με την πλευρική αλληλουχία DNA ξενιστή και την αλληλουχία T-DNA. Τα αποτελέσματα της ενίσχυσης PCR έδειξαν ότι η ζώνη του DNA στόχου μπορούσε να ληφθεί όταν χρησιμοποιήθηκε γονιδιωματικό DNA G2-6 ως εκμαγείο (Συμπληρωματικό Σχήμα S2A). Τα αποτελέσματα της αλληλουχίας Sanger επαλήθευσαν ότι ο τόπος εισαγωγής Τ-DNA του G2-6 μπορούσε να χαρακτηριστεί επιτυχώς χρησιμοποιώντας WGS. Ωστόσο, τα αποτελέσματα της αλληλουχίας Sanger έδειξαν ότι η μη σκόπιμη αλληλουχία εισαγωγής είναι ένα θραύσμα DNA 482 bp που περιέχει μια αντίστροφη και συμπληρωματική αλληλουχία 328 bp της περιοχής T-DNA 24-351 bp, μια αντίστροφη και συμπληρωματική αλληλουχία 134 bp του περιοχή στο χρωμόσωμα 8 ρυζιού από 23685154 έως 23685287 bp και μια αλληλουχία 20 bp που μπορεί να προέρχεται από το ZH11 και να είναι μικρότερη από αυτή που ανιχνεύθηκε με την αλληλουχία PacBio.

Συζήτηση

Με την ανάπτυξη της τεχνολογίας αλληλουχίας υψηλής απόδοσης, το WGS έχει γίνει ευκολότερο και πιο γρήγορο. Το WGS είναι ένα ισχυρό εργαλείο για την ανίχνευση της αναδιάταξης του DNA και της παραλλαγής αριθμού αντιγράφων. Πρόσφατα, αποδείχθηκε ότι ο συνδυασμός WGS και βιοπληροφορικής είναι μια επιλεκτική στρατηγική για τον μοριακό χαρακτηρισμό διαγονιδιακών συμβάντων. Έχουν αναφερθεί διαφορετικοί αγωγοί τεχνολογίας για την ανάλυση του αριθμού αντιγράφων, των θέσεων εισαγωγής ή των πλευρικών ακολουθιών (Kovalic et al., 2012; Lepage et al., 2013; Zastrow-Hayes et al., 2015; Guo et al., 2016; Park et al., 2017· Zhang et al., 2020). Σε αυτή τη μελέτη, προσδιορίσαμε τον αριθμό αντιγράφου, τη θέση εισαγωγής και την πλευρική αλληλουχία του γονιδιώματος του ξενιστή και εντοπίσαμε την εισαγωγή ραχοκοκαλιάς φορέα και ακούσια ενσωμάτωση στο G2-6 χρησιμοποιώντας τη διοχέτευσή μας. Βρήκαμε ένα αντίγραφο της εισαγωγής Τ-DNA στο χρωμόσωμα 8 σε ρύζι G2-6 με 482-bp ακούσια αλληλουχία εισαγωγής και χωρίς υπολειμματική εισαγωγή σκελετού φορέα. Τα αποτελέσματα έδειξαν ότι το WGS σε συνδυασμό με τον αναπτυγμένο αγωγό είναι μια αποτελεσματική στρατηγική για τον λεπτομερή μοριακό χαρακτηρισμό διαγονιδιακών συμβάντων.

Ένας επαρκής όγκος δεδομένων αλληλουχίας υψηλής ποιότητας είναι σημαντικός για τον μοριακό χαρακτηρισμό διαγονιδιακών συμβάντων όταν χρησιμοποιείται WGS σε συνδυασμό με μια προσέγγιση βιοπληροφορικής. Σε αυτή τη μελέτη, αξιολογήσαμε την επίδραση του βάθους αλληλουχίας (20×, 30×, 40× και 70×) στον μοριακό χαρακτηρισμό. Βρήκαμε ότι τα αποτελέσματα σχετίζονταν με τον αριθμό αντιγράφων που ελήφθη χρησιμοποιώντας δεδομένα WGS σε διαφορετικά βάθη αλληλουχίας. Ωστόσο, για την ανάλυση θέσης εισαγωγής και πλευρικής αλληλουχίας, απαιτείται υψηλό βάθος αλληλουχίας για να ληφθεί επαρκής αριθμός αναγνώσεων που περιέχουν πληροφορίες θέσης διασταύρωσης για αξιόπιστα αποτελέσματα (Πίνακας 3). Για το G2-6, μπορούσαμε να εξαγάγουμε τις αναγνώσεις της θέσης διασταύρωσης 5′ άκρου μόνο όταν το βάθος αλληλουχίας ήταν 70×. Αυτό το αποτέλεσμα είναι συνεπές με εκείνα σε ορισμένες προηγούμενες δημοσιεύσεις, υποδηλώνοντας ότι απαιτείται υψηλό βάθος αλληλουχίας για τον ακριβή μοριακό χαρακτηρισμό διαγονιδιακών γεγονότων (Wang et al., 2008; Ajay et al., 2011). Αξίζει να σημειωθεί ότι η τυχαία αλληλουχία των αναγνώσεων και η ανομοιόμορφη έξοδος δεδομένων εξέρχονται και είναι αναπόφευκτες κατά τη διαδικασία NGS. Η ποιότητα της βιβλιοθήκης DNA, η παρτίδα αλληλουχίας και η κατάσταση του οργάνου θα επηρεάσουν την ποιότητα και την ποσότητα των δεδομένων προσδιορισμού αλληλουχίας. Σε αυτή τη μελέτη, οι στατιστικές δεδομένων έδειξαν ότι τα δεδομένα αλληλουχίας 30× ήταν υψηλότερα από αυτά του 40×, που μπορεί να προκληθεί από τις διαφορετικές παρτίδες αλληλουχίας και τη βιβλιοθήκη DNA που χρησιμοποιήθηκε. Επομένως, για να ληφθούν πιο ακριβή δεδομένα, τα δείγματα δοκιμής και τα δείγματα ελέγχου θα πρέπει να αλληλουχούνται ταυτόχρονα. Αξίζει να σημειωθεί ότι η τυχαία αλληλουχία των αναγνώσεων και η ανομοιόμορφη έξοδος δεδομένων εξέρχονται και είναι αναπόφευκτες κατά τη διαδικασία NGS. Η ποιότητα της βιβλιοθήκης DNA, η παρτίδα αλληλουχίας και η κατάσταση του οργάνου θα επηρεάσουν την ποιότητα και την ποσότητα των δεδομένων προσδιορισμού αλληλουχίας. Σε αυτή τη μελέτη, οι στατιστικές δεδομένων έδειξαν ότι τα δεδομένα αλληλουχίας 30× ήταν υψηλότερα από αυτά του 40×, που μπορεί να προκληθεί από τις διαφορετικές παρτίδες αλληλουχίας και τη βιβλιοθήκη DNA που χρησιμοποιήθηκε. Επομένως, για να ληφθούν πιο ακριβή δεδομένα, τα δείγματα δοκιμής και τα δείγματα ελέγχου θα πρέπει να αλληλουχούνται ταυτόχρονα. Αξίζει να σημειωθεί ότι η τυχαία αλληλουχία των αναγνώσεων και η ανομοιόμορφη έξοδος δεδομένων εξέρχονται και είναι αναπόφευκτες κατά τη διαδικασία NGS. Η ποιότητα της βιβλιοθήκης DNA, η παρτίδα αλληλουχίας και η κατάσταση του οργάνου θα επηρεάσουν την ποιότητα και την ποσότητα των δεδομένων προσδιορισμού αλληλουχίας. Σε αυτή τη μελέτη, οι στατιστικές δεδομένων έδειξαν ότι τα δεδομένα αλληλουχίας 30× ήταν υψηλότερα από αυτά του 40×, που μπορεί να προκληθεί από τις διαφορετικές παρτίδες αλληλουχίας και τη βιβλιοθήκη DNA που χρησιμοποιήθηκε. Επομένως, για να ληφθούν πιο ακριβή δεδομένα, τα δείγματα δοκιμής και τα δείγματα ελέγχου θα πρέπει να αλληλουχούνται ταυτόχρονα. που μπορεί να προκληθούν από τις διαφορετικές παρτίδες αλληλουχίας και τη βιβλιοθήκη DNA που χρησιμοποιείται. Επομένως, για να ληφθούν πιο ακριβή δεδομένα, τα δείγματα δοκιμής και τα δείγματα ελέγχου θα πρέπει να αλληλουχούνται ταυτόχρονα. που μπορεί να προκληθούν από τις διαφορετικές παρτίδες αλληλουχίας και τη βιβλιοθήκη DNA που χρησιμοποιείται. Επομένως, για να ληφθούν πιο ακριβή δεδομένα, τα δείγματα δοκιμής και τα δείγματα ελέγχου θα πρέπει να αλληλουχούνται ταυτόχρονα.

Ως μία από τις πλατφόρμες με την υψηλότερη απόδοση, η Illumina προσφέρει το χαμηλότερο κόστος ανά βάση (van Dijk et al., 2014). Ωστόσο, ο περιορισμός ενός μικρού μήκους ανάγνωσης καθιστά την αλληλουχία Illumina ακατάλληλη για ορισμένες αναλύσεις μοριακού χαρακτηρισμού διαγονιδιακών συμβάντων, στις οποίες το ξένο θραύσμα DNA εισάγεται στην περιοχή με την επαναλαμβανόμενη αλληλουχία, οδηγώντας σε ακούσια αλληλουχία εισαγωγής ή αναδιάταξη DNA. Η αλληλουχία SMRT PacBio προσφέρει μεγαλύτερα μήκη ανάγνωσης και μια εναλλακτική λύση για να ξεπεραστεί αυτός ο περιορισμός (Rhoads and Au, 2015). Εδώ, λάβαμε μόνο την πλευρική αλληλουχία 5′ άκρου του T-DNA χρησιμοποιώντας δεδομένα αλληλουχίας Illumina λόγω της ακούσιας εισαγωγής στο άκρο 3′. Στη συνέχεια, λάβαμε την πλευρική ακολουθία 3′ άκρου, τη θέση εισαγωγής και τις πληροφορίες ακούσιας εισαγωγής μέσω των δεδομένων αλληλουχίας PacBio. Επομένως, πιστεύουμε ότι η αλληλουχία PacBio είναι πιο κατάλληλη για πολύπλοκα διαγονιδιακά συμβάντα, όπως εισαγωγή πολλαπλών αντιγράφων στον ίδιο τόπο, στοιβαγμένα διαγονιδιακά συμβάντα και επεξεργασία γονιδίων σε καλλιέργειες. Συγκεκριμένα, το ποσοστό σφάλματος της αλληλουχίας PacBio είναι σχετικά υψηλό (περίπου 11–15%) (Korlach, 2015). Επομένως, κατά την ανάλυση των πλευρικών ακολουθιών, η αλληλουχία Sanger θα πρέπει να συνδυάζεται με την τεχνολογία αλληλουχίας PacBio για να διασφαλιστεί η ακρίβεια του αποτελέσματος. Από την άλλη πλευρά, οι αδυναμίες του PacBio, δηλαδή η χαμηλότερη απόδοση και το υψηλότερο κόστος σε σύγκριση με αυτά της αλληλουχίας Illumina, περιορίζουν επίσης την εφαρμογή του (Rhoads and Au, 2015). το ποσοστό σφάλματος της αλληλουχίας PacBio είναι σχετικά υψηλό (περίπου 11–15%) (Korlach, 2015). Επομένως, κατά την ανάλυση των πλευρικών ακολουθιών, η αλληλουχία Sanger θα πρέπει να συνδυάζεται με την τεχνολογία αλληλουχίας PacBio για να διασφαλιστεί η ακρίβεια του αποτελέσματος. Από την άλλη πλευρά, οι αδυναμίες του PacBio, δηλαδή η χαμηλότερη απόδοση και το υψηλότερο κόστος σε σύγκριση με αυτά της αλληλουχίας Illumina, περιορίζουν επίσης την εφαρμογή του (Rhoads and Au, 2015). το ποσοστό σφάλματος της αλληλουχίας PacBio είναι σχετικά υψηλό (περίπου 11–15%) (Korlach, 2015). Επομένως, κατά την ανάλυση των πλευρικών ακολουθιών, η αλληλουχία Sanger θα πρέπει να συνδυάζεται με την τεχνολογία αλληλουχίας PacBio για να διασφαλιστεί η ακρίβεια του αποτελέσματος. Από την άλλη πλευρά, οι αδυναμίες του PacBio, δηλαδή η χαμηλότερη απόδοση και το υψηλότερο κόστος σε σύγκριση με αυτά της αλληλουχίας Illumina, περιορίζουν επίσης την εφαρμογή του (Rhoads and Au, 2015).

Συχνά, ορισμένες αναγνώσεις χαρτογραφούνται στη ραχοκοκαλιά των πλασμιδίων φορέα κατά τη λήψη πληροφοριών εισαγωγής κορμού χρησιμοποιώντας το WGS. Αυτές οι αναγνώσεις μπορεί να προέρχονται από την αληθινή εισαγωγή της ραχοκοκαλιάς, μια ομόλογη αλληλουχία της ραχοκοκαλιάς στο γονιδίωμα του ξενιστή ή από μόλυνση κατά την προετοιμασία της βιβλιοθήκης DNA. Η πηγή μπορεί να προσδιοριστεί μέσω ανάλυσης επιπέδου κάλυψης και ευθυγράμμισης με το γονιδίωμα του ξενιστή (Cade et al., 2018). Τρεις αναγνώσεις στα δεδομένα αλληλουχίας G2-6 Illumina χαρτογραφήθηκαν στη ραχοκοκαλιά της πλασμιδικής αλληλουχίας pUBIG2 όταν το βάθος προσδιορισμού αλληλουχίας ήταν 70×. Αυτές οι αναγνώσεις ευθυγραμμίζονται με την περιοχή των 4427–4663 bp της αλληλουχίας κορμού pUBIG2. Το επίπεδο κάλυψης αυτών των αναγνώσεων ήταν πολύ χαμηλότερο από αυτό της περιοχής T-DNA. Η ευθυγράμμιση BLAST έδειξε ότι δεν είναι ομόλογες αλληλουχίες στο γονιδίωμα του ρυζιού. Συνδυάζοντας αυτό το αποτέλεσμα με τα αποτελέσματα ότι δεν αντιστοιχίστηκαν αναγνώσεις στην περιοχή ραχοκοκαλιάς του pUBIG2 όταν το βάθος αλληλουχίας ήταν 20×, 30× και 40×, πιστεύουμε ότι αυτές οι αναγνώσεις είναι ψευδώς θετικά που προκαλούνται από μόλυνση, η οποία είναι πολύ συχνή και δύσκολη. να αποφευχθεί εντελώς. Αυτή η μόλυνση επιβεβαιώθηκε με ενίσχυση PCR χρησιμοποιώντας εκκινητές σχεδιασμένους για την αντίστοιχη αλληλουχία περιοχής κορμού.

Δήλωση διαθεσιμότητας δεδομένων

Τα ακατέργαστα δεδομένα αλληλουχίας που αναφέρονται σε αυτό το άρθρο έχουν κατατεθεί στο Αρχείο Ακολουθιών Γονιδιώματος (Genomics, Proteomics amp; Bioinformatics 2017) στο National Genomics Data Center (Nucleic Acids Res 2020), Beijing Institute of Genomics (China National Center for Bioinformation), China Academy of Sciences, με αριθμό πρόσβασης CRA003306 (για G2-6) και CRA003307 (για Zhonghua 11) που είναι δημόσια προσβάσιμες στη διεύθυνση https://bigd.big.ac.cn/gsa. Οι παραγγελίες, ο κώδικας, η λεπτομερής τεκμηρίωση του αγωγού και οι ρυθμίσεις παραμέτρων είναι απόρρητα στη μόνιμη δημόσια πλατφόρμα GitHub (https://github.com/GUOWEIJUN/NGS).

Συνεισφορές Συγγραφέων

Οι ZW και XW συνέλαβαν και σχεδίασαν τα πειράματα. Ο SM έκανε τα πειράματα. Οι XW και YJ ανέλυσαν τα δεδομένα και έγραψαν το χειρόγραφο. Ο JY βελτίωσε τη γλώσσα. Όλοι οι συγγραφείς συνέβαλαν στο άρθρο και ενέκριναν την υποβληθείσα έκδοση.

Χρηματοδότηση

Αυτή η μελέτη υποστηρίχθηκε από το Μείζον Πρόγραμμα της Κίνας για τις Νέες Ποικιλίες Καλλιέργειας ΓΤΟ (Αρ. επιχορήγησης 2016ZX08010-003).

Σύγκρουση συμφερόντων

Οι συγγραφείς δηλώνουν ότι η έρευνα διεξήχθη απουσία εμπορικών ή οικονομικών σχέσεων που θα μπορούσαν να ερμηνευθούν ως πιθανή σύγκρουση συμφερόντων.

Συμπληρωματικό υλικό

Το συμπληρωματικό υλικό για αυτό το άρθρο βρίσκεται στο διαδίκτυο στη διεύθυνση: https://www.frontiersin.org/articles/10.3389/fpls.2020.573871/full#supplementary-material

Συμπληρωματικό Σχήμα 1 | Παραγγελίες βιοπληροφορικού λογισμικού που χρησιμοποιήθηκαν σε αυτή τη μελέτη.

Συμπληρωματικό Σχήμα 2 | Επιβεβαίωση των θέσεων εισαγωγής και των πλευρικών αλληλουχιών με ενίσχυση PCR και αλληλουχία Sanger. (Α) Ενίσχυση PCR πλευρικών αλληλουχιών 5′ και 3′. Μ υπάρχει δείκτης DNA 2 kb. 1 παρουσιάζει 5′ πλευρικές αλληλουχίες ενίσχυση του G2-6. 2 παρουσιάζουν 3′ πλευρικές αλληλουχίες ενίσχυση του G2-6. 3 παρουσιάζουν αρνητικό έλεγχο ZH11 για 5′ πλευρικές αλληλουχίες ενίσχυση του G2-6. 4 παρουσιάζουν αρνητικό έλεγχο ZH11 για 3′ πλευρικές αλληλουχίες ενίσχυση του G2-6. (Β) Ευθυγράμμιση της πλευρικής αλληλουχίας 5′ που ελήφθη με την αλληλουχία PacBIo και την αλληλουχία Sanger. (Γ) Ευθυγράμμιση της 3′ πλευρικής αλληλουχίας που λήφθηκε με την αλληλουχία PacBIo και την αλληλουχία Sanger.

Αλληλουχία πλήρους γονιδιώματος, μοριακός χαρακτηρισμός, αριθμός αντιγράφου, πλευρική αλληλουχία, διαγονιδιακό συμβάν, θέση εισαγωγής

Αφήστε μια απάντηση

Η ηλ. διεύθυνση σας δεν δημοσιεύεται. Τα υποχρεωτικά πεδία σημειώνονται με *